Gelecekte zenginlik GEN´lerde!
Ufuk Tarhan’ın sosyal medya, blog, kitap, vb. linkleri:  https://taplink.cc/futuristufuk

Geçmişte, bilgiyi etkin iletebilen ve kullanabilenler, dünyaya hükmedip daha zengin ve kudretli
olmuşlar... Her çağda, bilgi üretme, kullanma ve aktarmada egemen olan, dünyaya da hükmetmiş.
Dünya nimet ve kaynaklarından en fazla yararlanan olmuş.


Bilgiyi aktarma, kullanma ve çoğaltma işi, mağara duvarlarına kazınan resimlerden başlamış;
çiviyazısı, resimyazı ve Latin alfabesine kadar uzanmış. Alfabe neredeyse, alemin kralı o toplum
olmuş!

Şimdilerde kullandığımız alfabe ne? A, B, C mi diyorsunuz? Hayır! Artık, alfabemiz 1 ve 0.

Milenyum insanlarının çoğu, neredeyse dünyanın ana dili haline gelen 1 ve 0’dan ibaret iki sembollük
dijital alfabe kullanıyor. İnsanlar bu alfabeyle “ses, görüntü ve bilgiyi” inanılmaz hız ve doğrulukla
iletiyor. Sihir gibi bir şey bu alfabe. Dijital olarak telefon sesi ilettiğinde, “Merhaba”yı duyduğumuzda,
geri plandaki kodlama sisteminde 01000100 00110110 11011011 00010110 11011011 10011000
11110011
yazıyor. Birkaç 1 ve 0 yer değiştirince ise mesaj “Güle güle”, 11001100 10000010 11100011
10101000 10001010 00000011 11100111 00010001 00000001
oluyor.

Sadece iki rakamın konumu değiştirilerek yaratılan yeni bilgi platformu, sosyal, psikolojik, ekonomik,
teknolojik, vs. alanlarda her şeyi inanılmaz hızla değiştirdi, değiştiriyor.

Peki bu, gelebileceğimiz son nokta mı? Tabii ki hayır! Yeni egemen alfabe ATCG olacak! Nasıl mı?

2001’de, insanın genetik şifresinin, DNA’sının (deoksiribonükleik asit) yapısı çözüldü! Nedir bu DNA
dedikleri?

Tüm yaşam biçimlerinin kodlarını içinde barındıran bir molekül. DNA, iplerle bağlanmış, kendi
ekseninde dönen bir asma merdivene benziyor. Molekülün kenarları, şeker ve fosfattan, basamakları
da 4 maddeden oluşuyor: Adenin-A, Timin-T, Sitozin-C, Guanine-G. Kısaca ATCG. 1995’ten bu yana,
bilim insanlarının gündeminde.

Her canlı, hücresinde, o canlının genetik kodunu taşıyor. Bizim genetik kodumuzda, üç milyar harf
(A, T, C, G) var ve bu kod, sahip olduğumuz elli trilyon hücrenin her birinin içinde tekrarlanıyor. Nasıl
SARP kelimesini yeniden dizip PARS, DORMITORY kelimesini yeniden dizip DIRTY ROOM, 0 ve 1’lerin
yerini  değiştirdiğimizde  ise  GÜLE  GÜLE  ya  da  MERHABA  örneğindeki  gibi  farklı  sonuçlar  elde
ediyorsak, ATCG dizisini değiştirdiğimizde de organizma tepeden tırnağa değişiyor!

İnsan genleri, solucanlarınkilerden üçte bir oranında fazla. Genlerimizin yüzde 99’unun karşılığı, bir
biçimde farelerde var. Bu yüzden fare, en fazla kullanılan denek hayvanı. Şempanzelerin bir türünün
DNA’sı, insanınkiyle yüzde 98,5 oranında örtüşüyor. Genomdaki küçük değişiklikler, insanları uzun,
kısa,  şişman,  ince,  sarışın,  kızıl,  sağlıklı ya da çok hasta yapmaya yetiyor. Üç milyon harften oluşan
sıtma kodunun içindeki bir A harfi yerine G harfi koyulursa, hastalık öldürücü hale geliyor.

Şuraya   geliyoruz.  Gezegendeki  tüm  canlıları  kodlayan  bu  dili - genetik  alfabeyi - anlamayı  ve
kullanmayı  başaran  bireyler,  kurumlar,  topluluklar  ve  ülkeler,  idareyi  ele  geçirecek  Geleceğin
zenginleri ve hükmedenleri onlar olacak. Dünyadaki patent savaşlarının sebebi budur.

Geçen yıl, bir konuşma için gittiğim ve gelecek için umutsuz bir hava içinde olduklarını algıladığım
genetik fakültesi öğrencilerinin bu yazıyı okumalarını ve ne kadar kıymetli bir dalda ilerlediklerini
anlamalarını dilerim. Bu dallara hâlâ önem vermeyenlerin durumu fark etmelerini ise Tanrı´dan niyaz
ederim! Diğer bölümlerde okuyan gençlere de muhakkak mesleklerinin genetikle ilgili buluşma
noktalarını gözlemelerini öneririm. Örneğin, genetik laboratuvarı ya da şirketi sözleşmeleri, hukuku
vs. üzerinde uzman bir avukat, 20 yıl sonra ne demek olacak, hayal edebiliyor musunuz? Ya genetik
laboratuvarı inşasında, makine imalatında ve tasarımında uzman mühendisler?

Konunun başlığı, sanırım bu noktada iyi bir yazı sonu olacak: Gelecekte zenginlik GEN’de, gelecek de
peşinizde!

********************************* 

Kaynak: Juan Enriquez, “Gelecek Peşinizde”

Şüphesi olanlara, aşağıda 03. 02. 2008 tarihli gazete haberini hatırlatıyorum:

DNA’nın üstüne imzasını atmış!

İlk kez bir bakterinin sentetik genomunu (DNA dizilimi) oluşturup bunu yakında canlı bir hücreye
yerleştirerek tarihteki "ilk yapay organizma"yı yaratmaya hazırlanan Amerikalı biyolog ve girişimci
Craig Venter’ın, söz konusu DNA’nın genetik koduna kendi ismini yazdığı ortaya çıktı.

Altmış bir yaşındaki bilimadamı ve girişimci Craig Venter, kimyasal maddeler kullanarak yarattığı ilk
sentetik genomun "filigran" olarak bilinen genetik kod dizilerinden birine, açılımı "Craig Venter"
olan "TTAACTAGCTA ATGTCGTGCAATTGGAGTAG AGAACACAGAACG ATTAACTAGCTAA" şifresini
yerleştirdi. Venter, daha önce de  insanın  genetik  şifresini  çözmek  için  başladığı  çalışmada  kendi
DNA’sını kullanarak tartışma yaratmıştı.

2000´da TIME´a kapak olan bu makale
çarpıcı...
 Nasıl bir geleceğe ilerlediğimize dair hayati ipuçları
içeriyor...

                                                                                     *************************

Daha iyi bir gelecek için hizmetlerimiz hakkında bilgilenmek, 
Seminer-Workshop-Moderasyon-İçerik-Etkinlik Kurgusu vb. talepleri için görüşmek, 
Özel-özgün çalışmalarla işinize, hayatınıza dair iyileştirmeler yapmak üzere 
Antrenörlük almak 
Stratejik Danışmanlık, İş Tasarımı ve Avatarlığı hizmetlerimizden yararlanmak isterseniz;

Başvuru ve sorularınız için lütfen > burayı tıklayınız

Hizmetlerimiz & Eğitim &  Seminerlerimiz     I     M-GEN Resmi Sitesi (Referans ve Projelerimiz)

Ufuk Tarhan´ın yazı ve haberlerini  Twitter ve Facebook dan takip edebilirsiniz.